Puc57 Kan. PDF filepucgwkan sequence (2626 bp) tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagactgtcacagcttgtctgtaagcgg.
Circular Dumbbell Mir 34a 3p And 5p Suppresses Pancreatic Tumor Cell Induced Angiogenesis And Activates Macrophages from 5p suppresses pancreatic tumor cell …
Gene Synthesis Service Specifications Below is the price table for standard gene synthesis services The turnaround time only applies to the noncomplex sequences The genes will be cloned into our default pUC57Amp or pUC57Kan vectors with multiple cloning sites We can also clone the genes into customers’ supplied vectors upon request.
pUC57 Kan Vector Map GenScript
pUC57Kan vector Sequence Copy Sequence Download GeneBank File (gb) LOCUS Exported 2579 bp dsDNA circular SYN 25112013 DEFINITION Cloning vector with a kanamycin resistance marker suitable for generating ExoIII deletions ACCESSION VERSION .
DNA Synthesis Genome Editing Molecular Biology
1 pUC57Amp Sequence map “Cloning vector with an ampicillin resistance marker suitable for generating ExoIII deletions” The pUC57’s MCS contain 6 restriction sites with 3’ends that are resistant to ExoIII Source wwwsnapgenecom 2 pUC57Kan “Cloning vector with a kanamycin resistance marker suitable for generating ExoIII deletions” 3 pUCSP.
pUC57Kanamycin plasmid
pUC57Kanamycin Description pUC57Kanamycin Sequence LOCUS Exported File 2579 bp dsDNA circular SYN 0222015 DEFINITION ACCESSION VERSION KEYWORDS pUC57Kan SOURCE synthetic DNA construct ORGANISM synthetic DNA construct REFERENCE 1 (bases 1 to 2579) AUTHORS TITLE Direct Submission.
Circular Dumbbell Mir 34a 3p And 5p Suppresses Pancreatic Tumor Cell Induced Angiogenesis And Activates Macrophages
pUC57 map.ai GENEWIZ, Inc.
DysferlinExon41deletion in pUC57Kan 8575 bp
pUC57Kan Sequence and Map SnapGene
Version 7.1, Revision 20170926
pUCGWAmp Sequence (2671 bp)
Gene In Vector Gene Synthesis Bio Basic
and sequence pUC57Kan vector map novoprolabs.com
Platform Synbio DNA Synthesis Service Gene Synthesis